View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_low_57 (Length: 234)
Name: NF2585_low_57
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 53090966 - 53090762
Alignment:
| Q |
14 |
cataggaacaatatccaagaccaatagcatatccacccaccgctttggttctctttctgagatagtataacagaattgttctagtaaagtggacgcgaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53090966 |
cataggaacaatatccaagaccaatagcatatccacccaccgctttggctctctttctgagatagtataacagaattgttctagtgaagtggacgcgaag |
53090867 |
T |
|
| Q |
114 |
aaacgaagcttccaatcttcataccatatattatgccaattgtctcctttaatattgtccatttctactacacattactaactactacttataactaacc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53090866 |
aaacgaagcttccaatcttcataccatatattatgccaattgtctcctttaatattgtccatttctactacacattactaactactacttataaccaacc |
53090767 |
T |
|
| Q |
214 |
taatt |
218 |
Q |
| |
|
||||| |
|
|
| T |
53090766 |
taatt |
53090762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University