View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2585_low_64 (Length: 204)
Name: NF2585_low_64
Description: NF2585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2585_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 11 - 131
Target Start/End: Original strand, 52609737 - 52609857
Alignment:
| Q |
11 |
gcaaaggttgggattattgaattttatgttaatatgtaatttgtcgatttaaggagaatgaatcacatttttcagatttattgtatattgtatataagtg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52609737 |
gcaaaggttgggattattgaattttatgtcaatatgtaatttgtcgatttaaggagaatgaatcacattttccagatttattgtatattgtatataagtg |
52609836 |
T |
 |
| Q |
111 |
tggatcttgccttctaagtga |
131 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52609837 |
tggatcttgccttctaagtga |
52609857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University