View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_high_13 (Length: 263)
Name: NF2586_high_13
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 9 - 120
Target Start/End: Complemental strand, 48888536 - 48888425
Alignment:
| Q |
9 |
agcagagacagtaagaacctgtaannnnnnnnacttaatttaaactagaatgtaaatagcagcactgaacatctaaaatagcacaaataaattcataaca |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888536 |
agcagagacagtaagaacctgtaattttttttacttaatttaaactagaatgtaaatagcagtactgaacatctaaaatagcacaaataaattcataaca |
48888437 |
T |
 |
| Q |
109 |
tgttcctcctta |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48888436 |
tgttcctcctta |
48888425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 179 - 247
Target Start/End: Complemental strand, 48888367 - 48888299
Alignment:
| Q |
179 |
ggtgattaagctctcaagaatgttaaaccagtacagaatcgatttcacattgcaatcttatatacaatt |
247 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888367 |
ggtgattaagctctcaacaatgttaaaccagtacagaatcgatttcacattgcaatcttatatacaatt |
48888299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University