View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_high_15 (Length: 255)
Name: NF2586_high_15
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 26 - 246
Target Start/End: Original strand, 41288020 - 41288240
Alignment:
| Q |
26 |
caatgtcacccaagtattatccataaagttaaatgagaccggcgggtggtattacaattccattgttgggatggatcaccaagaaatgctagaattgacc |
125 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41288020 |
caatgtcacccaaatattatccataaagttaaatgagaccggcggatggtattgcaattccattgttgggatggatcaccaagaaatgctagaattgacc |
41288119 |
T |
|
| Q |
126 |
atcatatcacatttctcagtttcacaaaggnnnnnnnnnngatctacgatt-nnnnnnntactccattttcttaaacattttgggatatatgtaagcacg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41288120 |
atcatatcacatttctcagtttcacaaagg-aaaaaaaaagatctacgattaaaaaaaatactccattttcttaaacattttgggatatatgtaagcacg |
41288218 |
T |
|
| Q |
225 |
tgaaatattagtcttgatgatg |
246 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41288219 |
tgaaatattagtcttgatgatg |
41288240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University