View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_low_12 (Length: 291)
Name: NF2586_low_12
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 41 - 281
Target Start/End: Complemental strand, 5442099 - 5441868
Alignment:
| Q |
41 |
cattacaatgatactccgtnnnnnnnnttacattgttttgctgcaaaaattactcatttcatagtaattgttttacaaatgaaattctcacttttaggca |
140 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442099 |
cattacaatgatactccgtaaaaaaaattacattgttttgctgcaaaaattactcatttcatagtaattgttttacaaatgaaattctcacttttaggca |
5442000 |
T |
|
| Q |
141 |
ttatatagtgataactcatcatttactgtggggatatacgatcatacgatcacttattatgggnnnnnnnnnnnnnnnnnnnnnggcttaccagctcgtc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||| | |
|
|
| T |
5441999 |
ttatatagtgataactcatcatttactgtggg--------at-atacgatcacttattatgggtttttattttttattttattaggcttaccagctcgac |
5441909 |
T |
|
| Q |
241 |
acttttcctatgtgaagaacattgatcctgggttacctttg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441908 |
acttttcctatgtgaagaacattgatcctgggttacctttg |
5441868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University