View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_low_20 (Length: 248)
Name: NF2586_low_20
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 80 - 243
Target Start/End: Original strand, 487465 - 487629
Alignment:
| Q |
80 |
cacacagtggatgctttctattatttgaattcttgcttagagttacagattacaagataaatgaatgagaagta-gctgagttggaaacaagataaaata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
487465 |
cacacagtggatgctttctattatttgaattcttgcttagagctacagattacaagataaatgattgagaagtatgctgagttggaaaccagataaaata |
487564 |
T |
 |
| Q |
179 |
gagaatcctaaggttgatcaatgtcatataataatttcttcttgaagtacttttattttcttcga |
243 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
487565 |
gagaatcttaaggttgatcaatgttatataataatttcttcttgaagtacttttatttttttcga |
487629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 487386 - 487434
Alignment:
| Q |
1 |
aaatttatctcttcaacaatgttgttagaacggcagccatgttcacaat |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
487386 |
aaatttatctcttcaacaatgttgttagaacggcagccatgttcacaat |
487434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 87 - 134
Target Start/End: Original strand, 574195 - 574242
Alignment:
| Q |
87 |
tggatgctttctattatttgaattcttgcttagagttacagattacaa |
134 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
574195 |
tggatgctttctattatttgatttcaagcttagacttacagattacaa |
574242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University