View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_low_23 (Length: 242)
Name: NF2586_low_23
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 29175218 - 29174994
Alignment:
| Q |
18 |
gtaacagacaagtacatcactaatgatggcatgtcttgtgttattgtttttctttggctaagtgttaaattatatcaagggttgtcttataagttatata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29175218 |
gtaacagacaagtacatcactaatgatggcatgtcttgtgttattgtttttctttggctaagtgttaaattatatcaagggttgtcttataagttatata |
29175119 |
T |
 |
| Q |
118 |
actcattggaggccgtcttctctttttcaattcagggcgtatgcggaagttcttacttggacttatgacaaaagtgtggctcaggctagcgtgagcgagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29175118 |
actcattggaggccgtcttctctttttcaattcagggcgtatgcggaagttcttacttggacttatgacaaaagcgtggctcaggctagcgtgagcgagc |
29175019 |
T |
 |
| Q |
218 |
ctagcatatcgctcaccgtgcgcca |
242 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
29175018 |
ctagcatatcgttcaccgtgcgcca |
29174994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University