View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_low_26 (Length: 236)
Name: NF2586_low_26
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 35286969 - 35286747
Alignment:
| Q |
1 |
cttcacacattaatttttcggtatgagttttaatcgaattcacaacgtttgtcatccataatattttgtgtaggtttcaatcatcttgtccatggccaac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35286969 |
cttcacacattaatttttcagtatgagttttaatcgaattcacaactattgtcatccataatattttgtgtaggtttcaatcatcttgtccatggccaac |
35286870 |
T |
 |
| Q |
101 |
caacaacaggacttttttatttgtattattccgaaaatacagagattaannnnnnnagggataaaaatagagaatatttttatccaacaacacacctctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35286869 |
caacaacaggacttttttatttgtattatttcgaaaatacagagattaatttttttagggataaaaatagagaacatttttatccaacaacacacctctt |
35286770 |
T |
 |
| Q |
201 |
tgaagctaaaaatgatcatcgtg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35286769 |
tgaagctaaaaatgatcatcgtg |
35286747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University