View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_low_28 (Length: 235)
Name: NF2586_low_28
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_low_28 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 13773858 - 13773619
Alignment:
| Q |
1 |
catctatcaatcgaagtatttcactataatggtggctcatnnnnnnntttcacacttatattttctattattttgcttaattatgcgtacaattttgtac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13773858 |
catctattaatcgaagtatttcactataatggtggctcataaaaaaatttcacacttttattttctattattttgcttaattatgtgtacaattttgtac |
13773759 |
T |
|
| Q |
101 |
gagat-----aaatcttttcatcgtaaagaaaacaattcttttaacaaaacaattacatatggcaaagcttagcccacttggtttgttcgatggtattga |
195 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
13773758 |
gagatctttaatatcttttcatcgtaaagaaaacaattcttgtaacaaaacaattacatatggcaaagcttagcccacttggttggtccgatggtattga |
13773659 |
T |
|
| Q |
196 |
cttaggagttagtactcgaaagtgtgctcatctttaagat |
235 |
Q |
| |
|
|| | ||||| | || ||| ||||||||||| |||||||| |
|
|
| T |
13773658 |
ctcaagagtttggacccgagagtgtgctcatttttaagat |
13773619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University