View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2586_low_7 (Length: 356)
Name: NF2586_low_7
Description: NF2586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2586_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 59 - 341
Target Start/End: Complemental strand, 40509761 - 40509479
Alignment:
| Q |
59 |
ccacggtagagaactgttgggctatggtacatagtgtttggcccataactttgtttgtctctctctggcccatccaatctacttgcttttatgttttgtt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40509761 |
ccacggtagagaactgttgggctatggtacatagtgtttggcccataactttgtttgtctctctctggcccatccaatctacttgcttttatgttttgtt |
40509662 |
T |
|
| Q |
159 |
attcttacctcttttgttcactcaagcaaagttagttattctgttttagtggataactaatttcagttgtagccattttgggttggttgagtgactatga |
258 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40509661 |
attctaacctcttttgttcactcaagcaaagttagttattctattttagtggataactaatttcagttgtagccattttgggttggttgagtgactatga |
40509562 |
T |
|
| Q |
259 |
tcttcatgtaacgaatacatttcatttgactttaatttcgttcagtatgggacaactgtttatggggacaagatgatgttagt |
341 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40509561 |
tcttcatgtaaagaatacatttcatttgactttaatttcgttaagtatgggacaactgtttagggggacaagatgatgttagt |
40509479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University