View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2587_high_21 (Length: 270)
Name: NF2587_high_21
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2587_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 30739134 - 30739006
Alignment:
| Q |
124 |
aaataaccacagaaatgcatgaatcaagttaatgaagaaagtagataccaaaattggagaacaagaaatacttacattaaccaccattggggcaaatggc |
223 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30739134 |
aaataatcacagaaatgcatgaatcaatgtaatgaagaaagtagatgacaaaaatggggaacaagatatacttacattgaccaccattggggcaaatggc |
30739035 |
T |
 |
| Q |
224 |
tttgattctttttcttgctcaactggaat |
252 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
30739034 |
tttgattcttttgcttgctcaactggaat |
30739006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 14 - 92
Target Start/End: Complemental strand, 34519447 - 34519369
Alignment:
| Q |
14 |
cataggagaaggggaaacaatgtgaaaagcgaaaataatgtgatattgatatcatggttttggttttgatcatccgtga |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34519447 |
cataggagaaggggaaacaatgtgaaaagcgaaaataatgtgatattgatatcatggttttggttttgatcatccgtga |
34519369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University