View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2587_high_26 (Length: 250)
Name: NF2587_high_26
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2587_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 2113303 - 2113532
Alignment:
| Q |
20 |
gtaaccatgaccaaacatgaacatgaaacaccaccgtcaaaccgaacaaacctagcttcatgtttggtcgccaccgttttcttaatcttcattctcatca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2113303 |
gtaaccatgaccaaacatgaacatgaaacaccaccgtcaaaccgaacaaacctagcttcatgtttggtcgccaccgttttcttaatcttcattctcatca |
2113402 |
T |
 |
| Q |
120 |
taatcttcacactttacttcacacttttcaaacctcaagatccaaaaatctccgtcaccgccgttcaactcccatcattcaacctcaccaacaactccac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2113403 |
taatcttcacactttacttcacacttttcaaaccacaagatccaaaaatttccgtcaccgccgttcaactcccatcattcaacctcaccaacaactccac |
2113502 |
T |
 |
| Q |
220 |
caccgtcaacttcaccttctctcaatacac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2113503 |
caccgtcaacttcaccttctctcaatacac |
2113532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University