View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2587_high_40 (Length: 208)
Name: NF2587_high_40
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2587_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 21 - 177
Target Start/End: Original strand, 23292836 - 23292991
Alignment:
| Q |
21 |
tgaatccaaattaaatcacataaaataggatcagatcgggtcnnnnnnnaaaagtcatatgaactgagccatgggtacttgaattacctcataatcgatc |
120 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23292836 |
tgaattcaaactaaatcacataaaataggatcagatcgggtctttttttagaagtcatatgaaccgagccatgggtacttgaattaccgcataatcgatc |
23292935 |
T |
 |
| Q |
121 |
caaacggtttcacgaacaccccctactcatctcttctcccaattaatgacgagtata |
177 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23292936 |
caaacggtttcacgaaca-cccctactcatctcttctcccaattaatgacgagtata |
23292991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University