View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2587_high_40 (Length: 208)

Name: NF2587_high_40
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2587_high_40
NF2587_high_40
[»] chr5 (1 HSPs)
chr5 (21-177)||(23292836-23292991)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 21 - 177
Target Start/End: Original strand, 23292836 - 23292991
Alignment:
21 tgaatccaaattaaatcacataaaataggatcagatcgggtcnnnnnnnaaaagtcatatgaactgagccatgggtacttgaattacctcataatcgatc 120  Q
    ||||| |||| |||||||||||||||||||||||||||||||       | ||||||||||||| ||||||||||||||||||||||| |||||||||||    
23292836 tgaattcaaactaaatcacataaaataggatcagatcgggtctttttttagaagtcatatgaaccgagccatgggtacttgaattaccgcataatcgatc 23292935  T
121 caaacggtttcacgaacaccccctactcatctcttctcccaattaatgacgagtata 177  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
23292936 caaacggtttcacgaaca-cccctactcatctcttctcccaattaatgacgagtata 23292991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University