View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2587_low_16 (Length: 394)
Name: NF2587_low_16
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2587_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 45794878 - 45795106
Alignment:
| Q |
17 |
accatgaatttcgcagtctctgtagaattggcgctgcgcgactgcgtataagcttccttctccgccgtcaattttgcagttgaagaatgctgcatgatca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45794878 |
accatgaatttcgcagtctctgtagaattggcgctgcgcgactgcgtataagcttccttctccgccgtcaattttgcagctgaagaatgctgcatgatca |
45794977 |
T |
 |
| Q |
117 |
gaaagtacaaggagtgctgatgctcctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactgcatttcaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794978 |
gaaagtacaaggagtgctgatgctcctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactgcatttcaca |
45795077 |
T |
 |
| Q |
217 |
agagtcaaaatcaaatgttgttatgtgtg |
245 |
Q |
| |
|
||||| |||||||||||||||||| |||| |
|
|
| T |
45795078 |
agagtgaaaatcaaatgttgttatatgtg |
45795106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 279 - 384
Target Start/End: Original strand, 45795098 - 45795203
Alignment:
| Q |
279 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattgataaagatgattatcttctttag |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45795098 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattaataaagatgattatcttctttag |
45795197 |
T |
 |
| Q |
379 |
tctctg |
384 |
Q |
| |
|
|||||| |
|
|
| T |
45795198 |
tctctg |
45795203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University