View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2587_low_34 (Length: 239)
Name: NF2587_low_34
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2587_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 41742041 - 41742254
Alignment:
| Q |
13 |
cacagacgatacaattcttttcaataaatcatttatactctacctcaacaaccaaaacaatatgcgttttattggtttgacatataaaatcctaacaaac |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742041 |
cacagacgacacaattcttttcaataaatcatttatactctacctcaacaaccaaaacaatatgcgttttattggtttgacatataaaatcctaacaaac |
41742140 |
T |
 |
| Q |
113 |
atttaattaacttttatatatgtttgggtttataaaatttgaacta-----aatttctttgagacaagtttttactatatttagatctattatatcgata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742141 |
atttaattaacttttatatatgtttgggtttataaaatttgaactatgttaaacttctttgagacaagtttttactatatttagatctattatatcgata |
41742240 |
T |
 |
| Q |
208 |
tattttagatttat |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41742241 |
tattttagatttat |
41742254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University