View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2587_low_38 (Length: 235)
Name: NF2587_low_38
Description: NF2587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2587_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16306416 - 16306636
Alignment:
| Q |
1 |
ctatgtagccccaacacttcacattgaaaacgtgtttcatgtcttacataacaccgacacatgtacttctatcaactatttcattttcttaaattattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16306416 |
ctatgtagccccaacacttcacattgaaaacgtgtttcatgtcttacataacactgacacatgtacttctatcaactatttcatttttttaaattattat |
16306515 |
T |
|
| Q |
101 |
tagtgtcgacgcgtcaatgtcgtgtctatgtttcacagagcaaaacttctacactaatatttacaacaacggttgctattgagcaactgttgcctcgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16306516 |
tagtgtcgacgcgtcaatgtcgtgtctatgtttcacagagcaaaacttctacactaatatttacaacaacggttgctattgagcaactgttgcctcgcaa |
16306615 |
T |
|
| Q |
201 |
acacaatttctatgaacataa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16306616 |
acacaatttctatgaacataa |
16306636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 17930489 - 17930445
Alignment:
| Q |
81 |
tcattttcttaaattattattagtgtcgacgcgtcaatgtcgtgt |
125 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
17930489 |
tcattttcttaaattagtattggtgtcgacgtgtcaatgtcgtgt |
17930445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 111
Target Start/End: Original strand, 26462669 - 26462708
Alignment:
| Q |
72 |
tcaactatttcattttcttaaattattattagtgtcgacg |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
26462669 |
tcaattatttcattttcttaaattattatcagtgtcgacg |
26462708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 107
Target Start/End: Original strand, 30585132 - 30585160
Alignment:
| Q |
79 |
tttcattttcttaaattattattagtgtc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30585132 |
tttcattttcttaaattattattagtgtc |
30585160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University