View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2588_high_6 (Length: 227)
Name: NF2588_high_6
Description: NF2588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2588_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 86 - 221
Target Start/End: Complemental strand, 29209976 - 29209840
Alignment:
| Q |
86 |
gttcctattagattatcaccatcatccatctacaactcnnnnnnn-atatacgcaactattttctgcaatgcgagtttggtaactctttctcaatctgac |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29209976 |
gttcctattatattatcaccatcatccatctacaactcttttttttatatacgcaactattttctgcaatgcgagtttggtaactctttctcaatctgac |
29209877 |
T |
 |
| Q |
185 |
tagtacgtaatactctaagcctaaaccgatcaataac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29209876 |
tagtacgtaatactctaagcctaaaccgatcaataac |
29209840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 29210081 - 29210034
Alignment:
| Q |
1 |
taatcatatataagttaaccatatataatttgttattatttccttcac |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29210081 |
taatcatatataagttaaccatatataagttgttattatttccttcac |
29210034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University