View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2589_high_15 (Length: 236)
Name: NF2589_high_15
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2589_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 65 - 223
Target Start/End: Complemental strand, 2703773 - 2703622
Alignment:
| Q |
65 |
atgtaggaaaataatcttggtttgtcatgttcttatttacaatttctagtaaaactatttagactaataactaaactaaaaataagtttagtgactaatt |
164 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
2703773 |
atgtaggaaaataaacttgatttgtcatgttcttatttacaatttctagtaaaactatttagac---taactaaactaaatataagtttagtgactaatt |
2703677 |
T |
|
| Q |
165 |
tgctaaagttaattaattcactaactaaacatttgattatgtaacagtcgtatattttg |
223 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2703676 |
agctaa----cattaattcactgactaaaaatttgattatgtaacagtcgtatattttg |
2703622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University