View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2589_low_10 (Length: 266)
Name: NF2589_low_10
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2589_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 2223090 - 2222844
Alignment:
| Q |
1 |
aaaacgtggactcaccttaatagcatcttccatnnnnnnnnnnngcccaatcaccgatataaacccatgtgccgtggtggcgttttctccggtggttgat |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
2223090 |
aaaacgtggaatcaccttaatagcatcttccatcaccctcctccgcccaatcaccgatataaaaccatgtgacgcggtggcggtttctccggtggttgat |
2222991 |
T |
|
| Q |
101 |
tccatcgtaggaaccaccgccactttgcatggacgctttctcttccttctataatcatcgtaacgccgctcaatttctttagatttattaatattgtcgg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222990 |
tccatcgtaggaaccactgccactttgcatggacgctttctcttccttctataatcatcgtaacgccgctcaatttctttagatttattaatattgtcgg |
2222891 |
T |
|
| Q |
201 |
caacaatattattaggatcatccataatatttgacaacttcctctta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222890 |
caacaatattattaggatcatccataatatttgacaacttcctctta |
2222844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University