View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2589_low_12 (Length: 252)
Name: NF2589_low_12
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2589_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 532302 - 532071
Alignment:
| Q |
13 |
aatatggatcggactttaaacttcttcaaatccttcatttactaattttaagaaataaatttctaaccattagatcacatgatnnnnnnngtgttccttt |
112 |
Q |
| |
|
|||| ||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||| ||| |
|
|
| T |
532302 |
aatagggatcagacttcaaacttcttcgaatccttcatttactaattttaagaaataaatttctaaccattagatcatatgataaaaaaagtattctttt |
532203 |
T |
 |
| Q |
113 |
aatgtatttgtcataacgatagtcactatgatattattcatgtttcattatatacatatgtatcaaaccaaaattaatcttcattcaaaaaataatagca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
532202 |
aatgtatttgtcataacgatagtcactatgatattattcatgtttcattatatacatacttatcaaaccaaaattaatcttcattcaaaaaataatagca |
532103 |
T |
 |
| Q |
213 |
ttatcattcataataacgctttgtattaaata |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
532102 |
ttatcattcataataacgctttgtattaaata |
532071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University