View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2589_low_12 (Length: 252)

Name: NF2589_low_12
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2589_low_12
NF2589_low_12
[»] chr6 (1 HSPs)
chr6 (13-244)||(532071-532302)


Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 532302 - 532071
Alignment:
13 aatatggatcggactttaaacttcttcaaatccttcatttactaattttaagaaataaatttctaaccattagatcacatgatnnnnnnngtgttccttt 112  Q
    |||| ||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||       || ||| |||    
532302 aatagggatcagacttcaaacttcttcgaatccttcatttactaattttaagaaataaatttctaaccattagatcatatgataaaaaaagtattctttt 532203  T
113 aatgtatttgtcataacgatagtcactatgatattattcatgtttcattatatacatatgtatcaaaccaaaattaatcttcattcaaaaaataatagca 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
532202 aatgtatttgtcataacgatagtcactatgatattattcatgtttcattatatacatacttatcaaaccaaaattaatcttcattcaaaaaataatagca 532103  T
213 ttatcattcataataacgctttgtattaaata 244  Q
    ||||||||||||||||||||||||||||||||    
532102 ttatcattcataataacgctttgtattaaata 532071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University