View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2589_low_14 (Length: 248)
Name: NF2589_low_14
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2589_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 72 - 230
Target Start/End: Complemental strand, 11767036 - 11766878
Alignment:
| Q |
72 |
ttggataatatagagttaagttggtatctccttctgtagtaggtgttacaacaatatccacaatactcttatactttgcttatccccatagttgttgaag |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11767036 |
ttggataatatagagttaagttggtatctccttctgtagtaggtgttacaacactatccacaatactcttatactttgcttatccccatagttgttgaag |
11766937 |
T |
|
| Q |
172 |
cataaaaatgtctttttgaacaaggagattaagattgtgaaaattaacaagctgaacaa |
230 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11766936 |
cataaaaatgtgtttttgaacaaggagattaagattgtgaaaattaacaagctgaacaa |
11766878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University