View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2589_low_18 (Length: 227)
Name: NF2589_low_18
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2589_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 21 - 213
Target Start/End: Original strand, 531787 - 531986
Alignment:
| Q |
21 |
ggtatttgggtacatatactttgattttcttatgataataaataatgataaactacttgtttgtcatgggtaacaatgtgggnnnnnnnn---------- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | |||| |
|
|
| T |
531787 |
ggtatttgggtacatatactttgattttcttatgataataaat---gataaactacttgtttatcatgggtaacattatgggttttttttttctttttct |
531883 |
T |
|
| Q |
111 |
ccttgtttcttctaggttttctctaccaatgtaaattgtatttgagatattgtcgaacatgaaatgtgggcaattcaaaatttaaactttggtttatcat |
210 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
531884 |
cctagtttcttctaggttttctctaccgatgtaaattgtatttgagatattgtcgaacatgaaatgtggacaattcaaaatttaaactttggtttaccat |
531983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University