View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2589_low_9 (Length: 282)

Name: NF2589_low_9
Description: NF2589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2589_low_9
NF2589_low_9
[»] chr4 (1 HSPs)
chr4 (1-266)||(26701362-26701627)


Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 26701362 - 26701627
Alignment:
1 acaataaatattttggtgggtatcaaacggattaaggcaatgattatgacttgatatattaagatgatactatgcatgcaatgagggaattgacaaaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26701362 acaataaatattttggtgggtatcaaacggattaaggcaatgattatgacttgatatattaagatgatactatgcatgcaatgagggaattgacaaaatg 26701461  T
101 agaatattggtgcatataaaatcataataaaaataataattcaatgaatggataaaccttctctagccctcttgtactatacatgcatttggaattaatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26701462 agaatattggtgcatataaaatcataataaaaataataattcaatgaatggataaaccttctctagccctcttgtactatacatgcatttggaattaatc 26701561  T
201 atatattcttagaaaaagggaagcactaattaaggtgaacaatagatgataagttatggtctttca 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26701562 atatattcttagaaaaagggaagcactaattaaggtgaacaatagatgataagttatggtctttca 26701627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University