View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2591_high_5 (Length: 375)
Name: NF2591_high_5
Description: NF2591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2591_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 41467989 - 41467781
Alignment:
| Q |
18 |
tgtttcctcttctcgtgtgttgcttcattgattccaaaagaattttgttgatacccgtccattgatttacctatctattaggtagtacacttgcctcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41467989 |
tgtttcctcttctcgtgtgttgcttcattgattccaaaagaattttgttgatacccatccattgatttacctatctcttaggtagtacacttgcctcaaa |
41467890 |
T |
|
| Q |
118 |
agcttcttttattgga---ttacataagatgttttccagaatctcatcagacaattaactcaataaccgacatttcttgagtgatgtctaacaagacctg |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41467889 |
agcttcttttattggaaggttacataagatgttttccataatctcatcagac-attaacccaataaccgacatttcttgagtgatgtctaacaagacttg |
41467791 |
T |
|
| Q |
215 |
cgagatagca |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
41467790 |
cgagatagca |
41467781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 299 - 360
Target Start/End: Complemental strand, 41467703 - 41467641
Alignment:
| Q |
299 |
tttgttgaaatgaatcaataatctttatagtt-gttcaccacatacatgaatcacaccttatt |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41467703 |
tttgttgaaatgaatcaataatctttatagtttgttcaccacatacatgaatcacaccttatt |
41467641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University