View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2591_low_11 (Length: 317)
Name: NF2591_low_11
Description: NF2591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2591_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 52234324 - 52234113
Alignment:
| Q |
1 |
atgcagtttaattgtgatttgaaaa-gatttatggacacattacatctaataattccattttacctgtacattagagagaatttaggaactattaatatg |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52234324 |
atgcagtttaattgtgatttgaaaaagatttatgcatacattacatctaataattccattttacctgtacattagagagaatctaggaactattaatatg |
52234225 |
T |
|
| Q |
100 |
ataaattggcataattaagacatg----tgattgtatttgtagagagattttaggaaatatcaatattatgagctagtatttgttaggaatgaaccgcac |
195 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52234224 |
ataaattggcataattaagacatgtagatgattgtatttgtagagagattttaggaactatcaatattatgagctagtatttgttaggaatgaaccgcac |
52234125 |
T |
|
| Q |
196 |
gcgaatatgtca |
207 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52234124 |
gcgaatatgtca |
52234113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 259 - 316
Target Start/End: Complemental strand, 52234112 - 52234053
Alignment:
| Q |
259 |
gccaaacggtttatttcgattggtgagtttt--tatgtttgatggtttgtgagattttat |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52234112 |
gccaaacggtttatttcgattggtgagtttttatatgtttgatggtttgtgagattttat |
52234053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University