View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2591_low_15 (Length: 295)
Name: NF2591_low_15
Description: NF2591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2591_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 33054784 - 33055034
Alignment:
| Q |
18 |
cttcaattcaacaacttcacaggtccacttccaagcttaaacggtttaaactctcttcaagttttcatggcgagtggtaacagtttttcatcttttccta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33054784 |
cttcaattcaacaacttcacaggtccacttccaagcttaaacggtttaaactctcttcaagttttcatggcgagtggtaacagtttttcatcgtttccta |
33054883 |
T |
 |
| Q |
118 |
gtgannnnnnngctggtatgtctcagcttgtttctgttgagattgatgataacccttttgagccatgggagattcctgtgtctttgaaagatgcttcttc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054884 |
gtgatttttttgctggtatgtctcagcttgtttctgttgagattgatgataacccttttgagccatgggagattcctgtgtctttgaaagatgcttcttc |
33054983 |
T |
 |
| Q |
218 |
tcttcagaatttttctgctaataatgctaatgtgaagggtaagttacctga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054984 |
tcttcagaatttttctgctaataatgctaatgtgaagggtaagttacctga |
33055034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University