View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2592_high_12 (Length: 303)
Name: NF2592_high_12
Description: NF2592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2592_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 285
Target Start/End: Complemental strand, 34870838 - 34870569
Alignment:
| Q |
16 |
atcattcatcttacaagttttgatagacaatcatcacgagaataaccccaatctaaaaattaatgagcatagaatcctgacacacgtggttgtgtagaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34870838 |
atcattcatcttacaagttttgatagacaatcatcacgagaataaccccaatccaaaaattaatgagcataaaatcctgacacacgtggttgtgtagaat |
34870739 |
T |
|
| Q |
116 |
cattactattttcttaaattattatcagtgtttgtgtgtcgacatcaatgttgtatccaatgtgagggatgcatagcacatgacatgatccctttacatg |
215 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34870738 |
cactactattttctcaaattattatcagtgtttgtgtgtcgacatcaatgtcgtatccaatgtgagggatgcatagcacatgacatgatccctttacatg |
34870639 |
T |
|
| Q |
216 |
acttcctcttatacttgcatgtcgattttggtgaagaaattggtgaaatttgatggataggagagaagag |
285 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34870638 |
acttcctcttatacttgcatgtggagtttggtgaagaaattggtgaaatttgatggaaaggagagaagag |
34870569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University