View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2592_low_21 (Length: 237)
Name: NF2592_low_21
Description: NF2592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2592_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 40572643 - 40572844
Alignment:
| Q |
17 |
ctgacacgttaatactccgaagatcaagtttagtatgaaaaacaaggtaagtatatacgaaagtgtaggaaaatgaatcatatcatgaaggataaccatc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||| |||||| || ||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
40572643 |
ctgacacgttaatattccgaagatcaagtttagtataaaaaacaagggaagtatgtatgaaagtgtaggaagatgaatcatatcatgagggataaccatc |
40572742 |
T |
 |
| Q |
117 |
tccgtgttatccagatccgccccaaggcatgttctagtggagcaagacgtattgttgttgacgtggtctttcaggtaagttggtggatgtttttatccac |
216 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
40572743 |
tccgtgttatccaaatccgctccaaggcatgttctagtggagcaagacgtattgttgttgacgtggtctttcagataagtcagtggatgttttcatccac |
40572842 |
T |
 |
| Q |
217 |
gt |
218 |
Q |
| |
|
|| |
|
|
| T |
40572843 |
gt |
40572844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University