View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2592_low_26 (Length: 212)

Name: NF2592_low_26
Description: NF2592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2592_low_26
NF2592_low_26
[»] chr1 (1 HSPs)
chr1 (18-197)||(32973955-32974134)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 32974134 - 32973955
Alignment:
18 ctttaggtagggagatgagttcttatgggttgttcctcttcgtctctaatttattcatttgttacattttttcatctcttatcttgcacaacttcttcaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
32974134 ctttaggtagggagatgagttcttatgggttgttcctcttcgtctctaatttattcattagttacattttttcatctcttatcttgcacaacttcttcaa 32974035  T
118 atttcattggttcgaaatctgcagaggcataacaatgtgatattatcaatttccattgttttcttcataaagatcttcat 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32974034 atttcattggttcgaaatctgcagaggcataacaatgtgatattatcaatttccattgttttcttcataaagatcttcat 32973955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University