View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2592_low_27 (Length: 207)
Name: NF2592_low_27
Description: NF2592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2592_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 9455410 - 9455232
Alignment:
| Q |
18 |
aaaagaaggtttaagattcaattcttaaactggtaaagnnnnnnnnnn-caattgtacaattgaacataattagtaacttgtccataattcatacttcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9455410 |
aaaagaaggtttaagattcaattcttaaactggtaaagaaaaaaaaaaacaattgtacaattgaacataattagtaacttgtccataatttatacttcaa |
9455311 |
T |
 |
| Q |
117 |
ccgataataaaaatgttaaaattgttacgtcgaacatcataatcgtagttcgtactccatctccttcatttatatgtga |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9455310 |
ccgataataaaaatgttaaaattattacgtcgaacatcgtaatcgtagttcgtactccatctccttcatttatatgtga |
9455232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University