View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2593_high_13 (Length: 287)
Name: NF2593_high_13
Description: NF2593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2593_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 17 - 274
Target Start/End: Complemental strand, 34745540 - 34745283
Alignment:
| Q |
17 |
aagtctggtttcatgaaatggctcagtaagcttttcaaaggtgggtccaatagaggaaggagtggtcgtcatcattatgattctgcagaggaaggcatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34745540 |
aagtctggtttcatgaaatggctcagtaagcttttcaaaggtgggtccaatagaggaaggagtggtcgtcatcattatgattctgcagaggaaggcatgt |
34745441 |
T |
|
| Q |
117 |
cttggcgtgctccatctagagctttggtaaacaccaccactcaattcagttttcttcaataatatatagttattattcttgtttgttatgaatagaagaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34745440 |
cttggcgtgctccatctagagctttggtaaacaccaccactcaattcagttttcttcaataatatatagttattattcttgtttgttatgaatagaagaa |
34745341 |
T |
|
| Q |
217 |
attgcactattgttcttaaatgacacaaacacttcatctgttgacattgacctcccct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34745340 |
attgcactattgttcttaaatgacacaaacacttcatctgttgacattgacctcccct |
34745283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 31053370 - 31053442
Alignment:
| Q |
17 |
aagtctggtttcatgaaatggctcagtaagcttttcaaaggtgggtccaatagaggaaggagtggtcgtcatc |
89 |
Q |
| |
|
||||||||||| ||||||||| | | ||| |||||||| ||| ||||||||||||||| ||||| |||||| |
|
|
| T |
31053370 |
aagtctggttttatgaaatggtttggcaagattttcaaaattggatccaatagaggaaggggtggtggtcatc |
31053442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University