View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2593_low_22 (Length: 265)
Name: NF2593_low_22
Description: NF2593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2593_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 245
Target Start/End: Complemental strand, 42249755 - 42249522
Alignment:
| Q |
12 |
tcatcataaacgtaacaccaaagttgagtttagactgcaggatagatagctttataatcgataatgaccccaaattcctatccatctgacttcgccttgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42249755 |
tcatcataaacgtaacaccaaagttgagtttagactgcaggatagatagctttataatcgataatgaccccaaattcctatccatctgacttcaccttgg |
42249656 |
T |
 |
| Q |
112 |
agataatttggttcaaacacagctcagtgccccagttcagtgcagaaagaggaccccaagctcaccttaacagacgaaacagtctctcaccatacacaat |
211 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42249655 |
agataatttggttcaaactcagctcagtgccccagttcagtgcagaaagaggaccccaagctcaccttaacagacgaaatagtctctcaccatacacaat |
42249556 |
T |
 |
| Q |
212 |
ctgttttggctgggaaaaaatgatcttagttgtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42249555 |
ctgttttggctgggaaaaaatgatcttagttgtt |
42249522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University