View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2593_low_24 (Length: 251)
Name: NF2593_low_24
Description: NF2593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2593_low_24 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 8367776 - 8367531
Alignment:
| Q |
6 |
agaagcaaaggggattaggtatgttacaactt-ggtaaaggatgtaagaattaaggaagatcaagtgttcttccatgaccctataagaatatctcaatca |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8367776 |
agaagaaaaggggattaggtatgttacaactttggtaaaggatgtaagaattaaggaagatcaagtgttcttccatgaccctctaagaatatctcaatca |
8367677 |
T |
|
| Q |
105 |
tacatgtttcttcatgcctacttctttcaatggccatagccttaagagatctacttatgatctgtccagtgaagatcagtgatgaaggacggttttttcg |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || || |||| |
|
|
| T |
8367676 |
tacatgtttcttcatgcctgcttctttcaatggccatagccttaagagatctacttatgatctgtccagtgaagatcagtgatcaaggatgg-ttgttcg |
8367578 |
T |
|
| Q |
205 |
tggtgctccgatgcgacagaggttgagtcttcacaatgtaggagaaa |
251 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8367577 |
tggtgctccgatgcgatagaggttgagtcttcacaatgtaggagaaa |
8367531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 86
Target Start/End: Complemental strand, 8377105 - 8377024
Alignment:
| Q |
6 |
agaagcaaaggggattaggtatgttacaac-ttggtaaaggatgtaagaattaaggaagatcaagtgttcttccatgaccct |
86 |
Q |
| |
|
||||| |||||| || || ||||||||| | |||||| |||||| | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8377105 |
agaagaaaagggaatgagatatgttacagcattggtagaggatgaaggaattaaggtagatcaagtgttcttccatgaccct |
8377024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University