View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_high_14 (Length: 278)
Name: NF2594_high_14
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 8444179 - 8444371
Alignment:
| Q |
12 |
atgaatcttaatcaataatatattataatatgagataagatcaattgacttgtataattgtcaaaaataacttccttgtatagaagattatgcactctcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8444179 |
atgaatcttaatcaataatatattataatatgagataagatcaattgacttgtataattgtcaaaaataacttccttgtatagaagattatgcactctcc |
8444278 |
T |
|
| Q |
112 |
atatcatccatcatgattatcatcatgttttacattcaccatcgttctttgttggctttctcctgtttctttgtttcaaccatacccatgata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8444279 |
atatcatccatcatgattatcatcatgttttacattcaccatcgttctttgttggctttctcctgtttctttgtttcaaccatacccatgata |
8444371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University