View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_high_18 (Length: 256)
Name: NF2594_high_18
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_high_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 14 - 256
Target Start/End: Complemental strand, 1430193 - 1429966
Alignment:
| Q |
14 |
gagcagagagacacaaacctatctgaaggagatttggatcgcatatcagttgcgatgagacaagaagaagaagaagnnnnnnnnnnncgagagtgaagta |
113 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| | || || |||||||||||| |
|
|
| T |
1430193 |
gagcacagagacacaaatctatctgaaggagatttggatcgcatatcagttgagatgagacaagaaggaaaaaaaaaag---------gagagtgaagta |
1430103 |
T |
|
| Q |
114 |
tagtggaagagaaattatgatgatgaggatgggatctttcttgagtcaatatta-ttgttgtaaaagatgttaaggcaatttcgtggaaacttcctacat |
212 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430102 |
tagtggaagagaaactatgatga---ggataggatctt----gagtcaatatttgttgttgtaaaagatgttaaggcaatttcgtggaaacttcctacat |
1430010 |
T |
|
| Q |
213 |
tactggtacaccgactatcgtgcgcacacaccaaatgcaccaaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430009 |
tactggtacaccgactatcgtgcgcacacaccaaatgcaccaaa |
1429966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University