View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2594_high_22 (Length: 237)

Name: NF2594_high_22
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2594_high_22
NF2594_high_22
[»] chr5 (1 HSPs)
chr5 (1-222)||(36078810-36079031)
[»] chr8 (1 HSPs)
chr8 (1-90)||(36785277-36785366)


Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36078810 - 36079031
Alignment:
1 atcaggttgaataacattgccgataaaattgttaataaagattgccgttgaatatggcctccatggtcttgccaaataagtcttcgccgttgaagtataa 100  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
36078810 atcaggttgaataaaattgccgataaaattgttaataaagattgccgttgaatatggcctccatggtcttgccaaataagtcttcgacgttgaagtataa 36078909  T
101 ggtgcgaaatcataatctggaaggatggagcaatgatcaatgactataccagtacgtaaattgttgttttggtatgggccatctgccaccacaacattgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36078910 ggtgcgaaatcataatctggaaggatggagcaatgatcaatgactataccagtacgtaaattgttgttttggtatgggccatctgccaccacaacattgt 36079009  T
201 attggcctgaagcgggctttct 222  Q
    ||||||||||||||||||||||    
36079010 attggcctgaagcgggctttct 36079031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 36785366 - 36785277
Alignment:
1 atcaggttgaataacattgccgataaaattgttaataaagattgccgttgaatatggcctccatggtcttgccaaataagtcttcgccgt 90  Q
    |||||||||||||| ||  || |||| ||| |||||||| |||||| | ||| ||| ||||||||| |||||||||||||||||| ||||    
36785366 atcaggttgaataaaatcacctataacattattaataaatattgccctagaaaatgacctccatggccttgccaaataagtcttcaccgt 36785277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University