View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2594_high_3 (Length: 521)

Name: NF2594_high_3
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2594_high_3
NF2594_high_3
[»] chr3 (1 HSPs)
chr3 (337-439)||(24084553-24084655)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 337 - 439
Target Start/End: Complemental strand, 24084655 - 24084553
Alignment:
337 tatcttaatagagggtgagattcatcagagtgaaattgaagagatagttggatatggagatgaagtggaagagaatgagatacttgaagttgaggatgga 436  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |    
24084655 tatcttaatagagggtgagactcatgagagtgaaattgaagagatagttggagatggagatgaaatggaagagaatgagatacttgaagttgaggatgaa 24084556  T
437 cta 439  Q
    |||    
24084555 cta 24084553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University