View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_high_3 (Length: 521)
Name: NF2594_high_3
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 337 - 439
Target Start/End: Complemental strand, 24084655 - 24084553
Alignment:
| Q |
337 |
tatcttaatagagggtgagattcatcagagtgaaattgaagagatagttggatatggagatgaagtggaagagaatgagatacttgaagttgaggatgga |
436 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
24084655 |
tatcttaatagagggtgagactcatgagagtgaaattgaagagatagttggagatggagatgaaatggaagagaatgagatacttgaagttgaggatgaa |
24084556 |
T |
 |
| Q |
437 |
cta |
439 |
Q |
| |
|
||| |
|
|
| T |
24084555 |
cta |
24084553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University