View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_high_8 (Length: 340)
Name: NF2594_high_8
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 13378342 - 13378199
Alignment:
| Q |
18 |
atattgaggttgttccagtggattatgtaaatactgcaatggaacgcttagtcaaagctgatgtgaaatatcgatttgttattgacattggaaacacaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13378342 |
atattgaggttgttccagtggattatgtaaatactgcaatggaacgcttagtcaaagctgatgtgaaatatcgatttgttattgacattggaaacacaat |
13378243 |
T |
 |
| Q |
118 |
gaaggcaagctcttaaataactagatgggtttataaaaaattag |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13378242 |
gaaggcaagctcttaaataactagatgggtttataaaaaattag |
13378199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 13372604 - 13372491
Alignment:
| Q |
18 |
atattgaggttgttccagtggattatgtaaatactgcaatggaacgcttagtcaaagctgatgtgaaatatcgatttgttattgacattggaaacacaat |
117 |
Q |
| |
|
||||||||||| ||||| | |||||||| |||| ||||||||| || || |||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
13372604 |
atattgaggttattccaatagattatgtgaatagtgcaatggatcgtctactcaaagctgatgtgaaatatcgctttgttattgacattggaaacacgtt |
13372505 |
T |
 |
| Q |
118 |
gaaggcaagctctt |
131 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
13372504 |
gaaagcaagctctt |
13372491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 275 - 335
Target Start/End: Complemental strand, 13378084 - 13378024
Alignment:
| Q |
275 |
atctctctcgttgagaaagaacacatttgtgtttgttattgagtctttgttttagcctatg |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13378084 |
atctctctcgttgagaaagaacacatttgtgtttgttattgagtctttgttttagcctatg |
13378024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 13425688 - 13425595
Alignment:
| Q |
18 |
atattgaggttgttccagtggattatgtaaatactgcaatggaacgcttagtcaaagctgatgtgaaatatcgatttgttattgacattggaaa |
111 |
Q |
| |
|
|||||||||||||||| | |||||||| || || |||||||| || | | ||||| ||||||||||||||||| |||||||| |||||||| |
|
|
| T |
13425688 |
atattgaggttgttcctattgattatgtcaacacagcaatggagcgtctcgagaaagcagatgtgaaatatcgattcgttattgatattggaaa |
13425595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 13453158 - 13453114
Alignment:
| Q |
71 |
aaagctgatgtgaaatatcgatttgttattgacattggaaacaca |
115 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
13453158 |
aaagcagatgtgaaatatcgatttgtgattgatattggaaacaca |
13453114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 135
Target Start/End: Original strand, 13386148 - 13386263
Alignment:
| Q |
20 |
attgaggttgttccagtggattatgtaaatactgcaatggaacgcttagtcaaagctgatgtgaaatatcgatttgttattgacattggaaacacaatga |
119 |
Q |
| |
|
||||| |||||||| ||||||||||| || || ||||| || || | ||||||| ||||| |||||||||||||| | |||||||||||||| ||| |
|
|
| T |
13386148 |
attgaagttgttcctgtggattatgttaacacagcaattgagcgactcctcaaagcagatgtcaaatatcgatttgtgctcgacattggaaacactctga |
13386247 |
T |
 |
| Q |
120 |
aggcaagctcttaaat |
135 |
Q |
| |
|
| |||| |||||||| |
|
|
| T |
13386248 |
aaccaagttcttaaat |
13386263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 80 - 131
Target Start/End: Complemental strand, 13412374 - 13412323
Alignment:
| Q |
80 |
gtgaaatatcgatttgttattgacattggaaacacaatgaaggcaagctctt |
131 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |||| ||||||||| |
|
|
| T |
13412374 |
gtgaaatatcgatttgtgattgatattggaaacacactgaaaccaagctctt |
13412323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 135
Target Start/End: Complemental strand, 47600555 - 47600456
Alignment:
| Q |
36 |
tggattatgtaaatactgcaatggaacgcttagtcaaagctgatgtgaaatatcgatttgttattgacattggaaacacaatgaaggcaagctcttaaat |
135 |
Q |
| |
|
|||||||||| || ||||||||||| || | ||||||| ||||| |||||||||||||| ||||||||||||||||| | || ||||||||||||| |
|
|
| T |
47600555 |
tggattatgttaacactgcaatggagcgactcctcaaagcagatgtcaaatatcgatttgtgattgacattggaaacactctcaaaccaagctcttaaat |
47600456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University