View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_low_23 (Length: 245)
Name: NF2594_low_23
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 239
Target Start/End: Complemental strand, 29277694 - 29277462
Alignment:
| Q |
7 |
attttgcaatttatcttccgaacttagtggaagcatgcagtgacaaagattctgaaatcaaagaggtttcttatctttttgcgacctcggtgtcattctt |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29277694 |
attttgcaatttatcttccaaacttagtggaagcatgcagtgacaaagattctgaaatcaaagaggtttcttatctttttgcgacctcggtgtcattctt |
29277595 |
T |
|
| Q |
107 |
aatacagttattgtatatcattatttaatgattttgcccctttttcaggaagcagcaaggggaattcgaatttgtgccgagtttgggacaccaactttta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29277594 |
aatacagttattgtatatcattatttaatgattttgcccctttttcaggaagcagcaaggggaattcgaatttgtgctgagtttgggacaccaactttta |
29277495 |
T |
|
| Q |
207 |
agccttttatcaatagtatgctgtttgctctgt |
239 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
29277494 |
agccttttatcaatagtatgttgtttgctctgt |
29277462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University