View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_low_24 (Length: 241)
Name: NF2594_low_24
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 110 - 222
Target Start/End: Complemental strand, 47333856 - 47333744
Alignment:
| Q |
110 |
gacttaccaaggatgtctccaactttgaaagacttgccagaagcccaggttgtataagcagcagtaccgttagatggaatggtccagccaatggtgtcac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47333856 |
gacttaccaaggatgtctccaactttgaaagacttgccagaagcccaggttgtataagcagcagtaccgttagatggaatgatccagccaatggtgtcac |
47333757 |
T |
|
| Q |
210 |
caacggtgtaagt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47333756 |
caacggtgtaagt |
47333744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47333965 - 47333918
Alignment:
| Q |
1 |
tattattcaattctaacacttcattaatgacatgtgcaagatatctaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47333965 |
tattattcaattctaacacttcattaatgacatgtgcaagatctctaa |
47333918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University