View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_low_26 (Length: 237)
Name: NF2594_low_26
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36078810 - 36079031
Alignment:
| Q |
1 |
atcaggttgaataacattgccgataaaattgttaataaagattgccgttgaatatggcctccatggtcttgccaaataagtcttcgccgttgaagtataa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36078810 |
atcaggttgaataaaattgccgataaaattgttaataaagattgccgttgaatatggcctccatggtcttgccaaataagtcttcgacgttgaagtataa |
36078909 |
T |
 |
| Q |
101 |
ggtgcgaaatcataatctggaaggatggagcaatgatcaatgactataccagtacgtaaattgttgttttggtatgggccatctgccaccacaacattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36078910 |
ggtgcgaaatcataatctggaaggatggagcaatgatcaatgactataccagtacgtaaattgttgttttggtatgggccatctgccaccacaacattgt |
36079009 |
T |
 |
| Q |
201 |
attggcctgaagcgggctttct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36079010 |
attggcctgaagcgggctttct |
36079031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 36785366 - 36785277
Alignment:
| Q |
1 |
atcaggttgaataacattgccgataaaattgttaataaagattgccgttgaatatggcctccatggtcttgccaaataagtcttcgccgt |
90 |
Q |
| |
|
|||||||||||||| || || |||| ||| |||||||| |||||| | ||| ||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
36785366 |
atcaggttgaataaaatcacctataacattattaataaatattgccctagaaaatgacctccatggccttgccaaataagtcttcaccgt |
36785277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University