View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_low_28 (Length: 218)
Name: NF2594_low_28
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 4 - 193
Target Start/End: Complemental strand, 4140111 - 4139922
Alignment:
| Q |
4 |
atgaaaaagaagaccaaatttatattcaagacgttcgctgatgattaatctcaatcgaaggtaggggcgtaataatttgattaacttcgattttcaacta |
103 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4140111 |
atgaaaaagaagattaaatttatatccaagacgttcactgatgattaatctcaatcgaaggtaggggcgtaataatttaattaacttcgattttcaacta |
4140012 |
T |
 |
| Q |
104 |
attttttatctaagggattaaagaagttgagtagttaaaagttcatgattcaagt--tctaataagaaataaaatactaacataatattctt |
193 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
4140011 |
a--tttgatctaagggattaaagaagttgagtagttaaaagttcatgattcaaattctctaataagaaataaaatactaacataacattctt |
4139922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University