View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2594_low_5 (Length: 453)
Name: NF2594_low_5
Description: NF2594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2594_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 1 - 441
Target Start/End: Original strand, 39793599 - 39794039
Alignment:
| Q |
1 |
tgttttaatggtgttgatctaattttgaattggatgcgtgaaatgaagttgggatgttgggagtgtgatcatgtgtagattgttgggtgtgactgtgttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39793599 |
tgtttcaatggtgttgatctaattttgaattggatgcgtgaaatgaagttgggatgttgggagtgtgatcatgtgtagattgttgggtgtgactgtgttt |
39793698 |
T |
|
| Q |
101 |
aggggttggaccggtttgagcaccatttttacttgaatttttctaattcggctagttgttctttcatatcacaattttggttaaggtggccatatcaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39793699 |
aggggttggaccggtttgagcaccatttttacttgaatttttctaattcggctggttgttctttcatatcacaattttggttaaggtggccatatcaacc |
39793798 |
T |
|
| Q |
201 |
atagattttgtagatgacgtggagtctgtcatattattgtgtgatctacttttacatacatataagtaaattgttgtgactagtagaagaccgcgctaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39793799 |
atagattttgtagatgacgtggagtctgacatattattgtgtgatctacttttacatacagataagtaaattgttgtgactagtagaagaccgcggtaat |
39793898 |
T |
|
| Q |
301 |
aaatcatttaggggccattagagatggtattttctttatctgcaacttgatcaaacttcaccatgtaaaaatcgttgttgttgttatccattgtttcaaa |
400 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39793899 |
aaatcattcaggggccattagagatggtcttttctttatccgcaacttgatcaaacttcaccatgtaaaaatcgtttttgttgttatccattgtttcaaa |
39793998 |
T |
|
| Q |
401 |
attgtgttggagtttccacatttctttcgtatgtttttcat |
441 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39793999 |
attgtgttggagtttccacatttctttagtatgtttttcat |
39794039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University