View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2595_low_13 (Length: 225)
Name: NF2595_low_13
Description: NF2595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2595_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 13068289 - 13068491
Alignment:
| Q |
19 |
tagattgaaatgtgataattttagaagtttgtaattttcaattgttttttgttagatgtatgtatct--atagatcgaatcatgg--------gaatcta |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||| ||||||| |
|
|
| T |
13068289 |
tagattgaaatgtgatcattttagaagtttgtaattttcaattgttttttgttagatgtatgtatgtgtatagatcgaaccatgggattatgggaatcta |
13068388 |
T |
|
| Q |
109 |
aatataaaagtcaaacgtatgtgacaaaatctcactctcaaccaccaatggagaaacgcaattatc-gttgtcgttattgttttgctttagaaattgctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13068389 |
aatataaaagtcaaacgtatgtgacaaaatctcactctcaaccaccaatggagaaacgcaattatcggttgtcgttattgttttgctttagaaattgctt |
13068488 |
T |
|
| Q |
208 |
tgt |
210 |
Q |
| |
|
||| |
|
|
| T |
13068489 |
tgt |
13068491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University