View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2595_low_14 (Length: 216)
Name: NF2595_low_14
Description: NF2595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2595_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 200
Target Start/End: Complemental strand, 4139378 - 4139189
Alignment:
| Q |
7 |
aaaaaataactatcttttaattgttgaatattatagagatatccatgttacattacaagaattatgcatgcaagtcaagtcaagtcattgataaaaatat |
106 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4139378 |
aaaaaataactattttttacttgttgaatattatagagatatccatgttacattacaagaattatgca----agtcaagtcaagtcattgataaaaatat |
4139283 |
T |
 |
| Q |
107 |
attctaatagtttatgcatttgcctatatgattgattataaattgagtgcattattgcaatgtatcagtccttgatcaaaccaaaccatatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4139282 |
attctaatagtttatgcatttgcctatatgattgattataaattgagtgcattattgcaatgtatcagtccttgatcaaaccaaaccatatttg |
4139189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 149
Target Start/End: Complemental strand, 4130580 - 4130535
Alignment:
| Q |
104 |
tatattctaatagtttatgcatttgcctatatgattgattataaat |
149 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
4130580 |
tatattcaaatagtttatgcatttgcctatacgattcattataaat |
4130535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University