View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2595_low_15 (Length: 214)

Name: NF2595_low_15
Description: NF2595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2595_low_15
NF2595_low_15
[»] chr8 (3 HSPs)
chr8 (1-214)||(21182196-21182409)
chr8 (15-178)||(23177566-23177729)
chr8 (15-178)||(23186695-23186858)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 21182409 - 21182196
Alignment:
1 aacaacaactataatacctatgcaacgctcttggactcaggaaacttggtactattgaacgcctctaacaaagcgattttatggcagagttttaatcacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
21182409 aacaacaactataatacctatgcaacgctcttggactcaggaaacttggtactattgaacgcctctaacaaacagattttatggcagagttttaatcacc 21182310  T
101 ccacggatacccttttacctggaatgaacatcggacacgatattaacacagggtacactttgtctttgagatcatggacaactgcagaagaccctgctcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21182309 ccacggatacccttttacctggaatgaacatcggacacgatattaacacagggtacactttgtctttgagatcatggacaactgcagaagaccctgctcc 21182210  T
201 tggaccgtatactc 214  Q
    ||||||||||||||    
21182209 tggaccgtatactc 21182196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 23177566 - 23177729
Alignment:
15 tacctatgcaacgctcttggactcaggaaacttggtactattgaacgcctctaacaaagcgattttatggcagagttttaatcaccccacggataccctt 114  Q
    |||||| ||||| ||||||||| ||||||||||||||||  ||||    |||||| |||| |||||||||||||||||| |||||||||| |||||||||    
23177566 tacctacgcaaccctcttggacacaggaaacttggtactggtgaataattctaaccaagcaattttatggcagagttttgatcaccccacagataccctt 23177665  T
115 ttacctggaatgaacatcggacacgatattaacacagggtacactttgtctttgagatcatgga 178  Q
    || |||||||||||||| ||  |||||| | |||||||  |||||| ||| |||||||||||||    
23177666 ttgcctggaatgaacataggctacgatactgacacaggacacacttggtcattgagatcatgga 23177729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 23186695 - 23186858
Alignment:
15 tacctatgcaacgctcttggactcaggaaacttggtactattgaacgcctctaacaaagcgattttatggcagagttttaatcaccccacggataccctt 114  Q
    |||||| ||||| || |||||| ||||||||||||||||  ||||    |||||| |||  |||||||||||||| ||| || ||||||| |||||||||    
23186695 tacctacgcaaccctgttggacacaggaaacttggtactggtgaataagtctaaccaagtaattttatggcagagctttgataaccccaccgataccctt 23186794  T
115 ttacctggaatgaacatcggacacgatattaacacagggtacactttgtctttgagatcatgga 178  Q
    ||||||||||||| | | |||||||||| | |||||||    |||| ||| |||||||||||||    
23186795 ttacctggaatgaccttaggacacgatacttacacaggacgtacttggtcattgagatcatgga 23186858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University