View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2595_low_3 (Length: 317)
Name: NF2595_low_3
Description: NF2595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2595_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 47641818 - 47642106
Alignment:
| Q |
19 |
cctttatcatgcatgagtcacctggcacaaaaaatttcgaatatctagtgcttcgaacagcataaattgtgcagaaatgcactcacacacaattaatact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47641818 |
cctttatcatgcatgagtcacctggcacaaaaaatctcgaatatctagtgcttcgaacagcataaattgtgcagaaatgcacttacacacaattaatact |
47641917 |
T |
|
| Q |
119 |
atctccggttaaactacaacattttataaattgaaattaacaaccaaagcagttggtaggggaattctggcagctaatatgaaattttcgtgtagtgcac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47641918 |
atctccggttaaactacaacattttataaattgaaattaacaaccaaagcaattggtaggggaattctggcagctaatatgaaattttcgtgcagtgcac |
47642017 |
T |
|
| Q |
219 |
ctcaaatcaccgccgcttcgatttcgacctcgtatcaactttttccttcctttttatcttatttcatgtttctctattggtgcattcat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47642018 |
ctcaaatcaccgccgcttcgatttcgacctcgtatcaactttttccttcctttttatcttatttcatgtttctctattggtgcattcat |
47642106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University