View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2596_low_11 (Length: 217)

Name: NF2596_low_11
Description: NF2596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2596_low_11
NF2596_low_11
[»] chr8 (1 HSPs)
chr8 (17-198)||(38123793-38123974)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 38123793 - 38123974
Alignment:
17 agcataggtaatggggttaacagcgttggatgcagatgcaacgagaattgaatactatgctactgtgggagaaccaatgtgtgagcttaattatgttaaa 116  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38123793 agcatgggtaatggggttaacagcgttggatgcagatgcaacgagaattgaatactatgctactgtgggagaaccaatgtgtgagcttaattatgttaaa 38123892  T
117 tctgggcttggttactgtgattatgttgagggttttggtgatgaagctcctttaggagagcttattgatgtaagctgtttat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38123893 tctgggcttggttactgtgattatgttgagggttttggtgatgaagctcctttaggagagcttattgatgtaagctgtttat 38123974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University