View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2596_low_12 (Length: 209)

Name: NF2596_low_12
Description: NF2596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2596_low_12
NF2596_low_12
[»] chr1 (1 HSPs)
chr1 (1-156)||(40420341-40420496)


Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 40420496 - 40420341
Alignment:
1 ctgactttaataaaagagttgtactaatagtttaaaatagtaactcttgaagctcaaactatatagcaacaaggctcatggtaacttccctatatatatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40420496 ctgactttaataaaagagttgtactaatagtttaaaatagtaactcttgaagctcaaactatatagcaacaaggctcatggtaacttccctatatatatc 40420397  T
101 taatactccccaacagacacttatggcataatgaaaattaccgaataatgcgagaa 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40420396 taatactccccaacagacacttatggcataatgaaaattaccgaataatgcgagaa 40420341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University