View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2600_low_25 (Length: 290)
Name: NF2600_low_25
Description: NF2600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2600_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 43106240 - 43106523
Alignment:
| Q |
1 |
actgaaacatgggttcttaactttttattcatagtaaaatgtaaaatagtcttaggctacctacttgattaagctataagaaaggtgcaaaattatggtc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43106240 |
actgaaacatgggttcttaacttcttattcatagtaaaatctaaaatagtcttaggctacctacttgattaagttgtaagaaaggtgcaaaattatggtc |
43106339 |
T |
 |
| Q |
101 |
atactagtaa---------ttaagagtttcaaattgttttatggagtcagaattgtatgcaacatacaaaagagaattgtgttataaaactagtttatgt |
191 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43106340 |
atactagtaattaagagttttaagagtttcaaattgtgttatgcagtcagaattgtatgcaacatacaaaagagaattgtgttataaaactagtttatgt |
43106439 |
T |
 |
| Q |
192 |
tcccctcnnnnnnnnnnnnnnnnnnnctagtttatgtagaggaaattaagaaatgttaatactatgtgatgtgatattagaaac |
275 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43106440 |
tcccctcaaaaaacaaaaacaaaaaactagtttatgtagaggaaattaagaaatgttaatactatgtgatgtgatattagaaac |
43106523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University